Strains and plasmids used in this study are described in table S1. Strains are MG1655 derivatives (56). P1 transduction was used to introduce the lexA3 malB::Tn9 allele (SMR820 strain, provided by S. Rosenberg) in MG1655, the ΔsulA::kan allele [obtained from the Keio collection (57)] in MG1655, and the lexA51 malB::Tn9 allele (SMR4568 strain, provided by S. Rosenberg) in MG1655. The tisAB locus was deleted using the mini-λ system (58) and the pKD3 plasmid as template DNA for amplification of the chloramphenicol resistance cassette [ΔtisAB, 5′ GTGCCGTCAGCGCCTTAACCCCGCGTGAGCACACTGTGTTGTGTAGGCTGGAGCTGCTTC (forward); 5′ GGTTTCCCGCTCCCCTTTGGTGCGACTTGAATCTGAATTACATATGAATATCCTCCTTA (reverse)] as described by Datsenko and Wanner (59). The kanamycin and chloramphenicol resistance cassettes associated with sulA and tisAB deletions were removed by using the helper pCP20 thermosensitive plasmid encoding the FLP recombinase as described by Datsenko and Wanner (59). The fluorescence-based two-color system comprising two compatible plasmids (pET-GFP and pC17-Crimson) (28) was transformed in DJ624 (60), a derivative of MG1655 carrying a lacIq allele to allow for enhanced repression of the IPTG-inducible promoter upstream of the gfp gene.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.