After being treated with different formulations, the genomic DNA of A549 cells was harvested on day 3 using Dzup Genomic DNA Isolation Reagent (Sangon Biotech Co. Ltd., Shanghai, China) according to the manufacturer’s instructions. The sgRNA-targeted genomic locus was amplified with the High Fidelity PCR Master Mix (Sangon Biotech Co. Ltd., Shanghai, China) using the following primers: GGTGCTGCGAATGGTTGTGG and CAGCCTCCTCCAAATTCCAGC. To reduce nonspecific amplifications, the touchdown polymerase chain reaction (PCR) program [(92°C for 15 s and 74°C for 60 s) for 5 cycles, (95°C for 15 s and 72°C for 60 s) for 5 cycles, (95°C for 15 s and 70°C for 60 s) for 5 cycles, (95°C for 15 s and 68°C for 60 s) for 25 cycles, and 68°C for 5 min] was used. After purifying by gel extraction, indel formation efficiencies were detected according to the T7 Endonuclease I Kit (Viewsolid Biotech, Beijing, China). The digested DNA was analyzed using 2% agarose gel electrophoresis. Indel formation efficiencies were calculated by Image J.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.