vRNA and vDNA were extracted from various tissues using a phenol extraction protocol after tissue pieces were homogenized in 1 ml of TRI Reagent (Molecular Research Center) in 2-ml extraction tubes of Lysing Matrix D (MP Biomedicals) using Precellys 24 (Bertin Instruments). Total RNA and DNA were prepared from the homogenates following the manufacturer’s recommendations but specifically following the alternative, back-extraction method for DNA extraction. Recovered RNA and DNA were dissolved in minimal volumes of 10 mM tris-Cl at pH 8.0 and 10 mM tris-Cl at pH 9.0, respectively, for qRT-PCR and qPCR, as well as for use in various sequencing approaches, as described below. Quantification for vRNA and vDNA was performed using a real-time assay designed to encompass the molecularly tagged portion of the integrase gene, as previously described (31). To quantify the number of cells assayed, a qPCR assay for the single-copy rhesus CCR5 gene was used with the following primers: RHR5F01, 5′-CCAGAAGAGCTGCGACATCC-3′; RHR5R01, 5′-CTAATAGGCCAAGCAGCTGAGG-3′; and probe RHR5P01, 5′-(Texas Red) TTCCCCTACAAGAAACTCTCCCCGGTAAGTA (BHQ2)-3′. CEs were calculated based on diploid genome equivalents of the CCR5 gene.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.