We used the CRISPR-Cas9 design site crispr.mit.edu to identify guide RNAs (gRNAs) that target the putative Runx-Pmp22–binding region (Chr11 63114879-63115495). On the basis of efficiency and low frequency of off-target sites, we chose two gRNAs: mU6-driven gRNA 5′-AGTACAGGTTTCCCCCCTGG AGG-3′ and hU6-driven gRNA (reversely inserted into pLV vector) 5′-TGCGCATACAGAGTCCAACC AGG-3′, predicted to create a deletion of ~360 bps and result in deletion of five putative Runx-binding sites in Pmp22 gene. PCR products containing these two gRNAs were ligated into the pLV hUbC-Cas9-T2A-GFP backbone (plasmid #53190, Addgene, Cambridge, MA) after linearization using BsmB I (New England BioLabs, Ipswich, MA). This plasmid expressed the Cas9 protein, ligated two gRNAs, and GFP simultaneously (named pLV hUbC-Cas9-T2A-GFP-2gRNAs). Plasmids were sequenced to confirm proper insertion of gRNAs. Lentiviral particles were packaged as described (43). We incubated mouse neurofibroma SCs with pLV hUbC-Cas9-T2A-GFP-2gRNA lentivirus and Polybrene (8 μg/ml) for 16 hours and then changed to SC culture medium for 5 days. We FACS-sorted GFP high single cells at one cell per well to 96-well plates containing DMEM with 20% fetal bovine serum, β-heregulin (10 ng/ml) and forskolin (1 μM). Three to 4 weeks later, we screened clones by PCR. PCR primers are as follows: ACTAGACATGAAACGGTCTGC (forward) and GTTTATCCAGACCTGGCCATT (reverse). The anticipated PCR product lengths were 531 bps (WT) and 171 bps (knockout). Homozygous deletion was confirmed by sequencing on both directions.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.