ECs were obtained from either direct HUVECs (2D culture on Matrigel coating versus 3D in vesseloids) or CD31+ cells after CD31 magnetic bead sorting (HUVECs + SMCs on Matrigel-coated 2D culture versus HUVECs + SMCs in vesseloids). RNAs were extracted (RNeasy mini plus kit, 74134, QIAGEN) and reverse-transcribed (high-capacity cDNA reverse transcription kit, 4368814, Applied Biosystems). qPCR analysis was performed with the same amount of resulting cDNA using the following primers: PODXL, AACCCGGCCCAAGATAAGTG (forward) and GGCAGGGAGCTTAGTGTGAA (reverse); ITGβ1, GAAGGGTTGCCCTCCAGA (forward) and GCTTGAGCTTCTCTGCTGTT (reverse); NRP1, CAAGGCGAAGTCTTTTGAGG (forward) and CACCTGTGAGCTGGAAGTCA (reverse); NRP2 CTGTGGGTCATCCGTGAGGAC (forward) and ATGGGTTCCATGCAGTTCTCCAG (reverse); VCAM-1, CGTCTTGGTCAGCCCTTCCT (forward) and ACATTCATATACTCCCGCATCCTTC (reverse); ICAM-1 AGGCCACCCCAGAGGACAAC (forward) and ICAM-1 CCCATTATGACTGCGGCTGCTA (reverse); and GAPDH, CTGCACCACCAACTGCTTAG (forward) and AGGTCCACCACTGACACGTT (reverse).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.