Postnatal 0 to 3 day WT or Trem2−/− mice were used to prepare primary microglia. The procedure has been previously described (43). After 14 days of culture, primary microglia were collected and used for experiments. For small interfering RNA (siRNA) transfection, primary microglia were seeded overnight and then transfected with 50 nM siRNA using Lipofectamine RNAiMAX (Invitrogen, Waltham, MA, USA). Aβ phagocytosis assays were performed at 48 to 72 hours after transfection. siRNA sequences used are listed as follows: (i) Trem2 #1: uucuccugagcaaguuucuug, Trem2 #2: caucacucugaagaaccucca; (ii) CR3 #1: aucuuuccugcuaauucugag, CR3 #2: ccugcuaauucugaggucaca; (iii) GPR34 #1: auaaccaccaagcaaaguauu, GPR34 2#: cucauggaaugcacuuuauaa; (iv) MerTK #1: guuuaaucacaccauuggaca, MerTK #2: agauguugugauugacagaaa.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.