Digoxigenin-labeled antisense riboprobes were designed using partial skate (L. erinacea) and catshark (S. canicula) EST (expressed sequence tag) assemblies (SkateBase; skatebase.org) (58), the Vertebrate TimeCapsule (VTcap; transcriptome.cdb.riken.go.jp/vtcap), and transcriptome data from RNA sequencing (unpublished). Sequences of forward and reverse primers (Sigma) are as follows: chick β-cat, TCTCACATCACCGTGAAGGC (forward) and CCTGATGTCTGCTGGTGAGG (reverse); shark β-cat, GGTGAAAATGCTTGGGTCT (forward) and GGACAAGGGTTCCTAGAAGA (reverse); shark fgf4, ATGTTGATCAGGAAGCTGCG (forward) and GTATGCGTTGGATTCGTAGGC (reverse); shark shh, TGACTCCCAATTACAACCCGG (forward) and TCAGGTCCTTCACTGACTTGC (reverse); shark bmp4, GATCTCTACAGGCTGCAGTCC (forward) and GATCTCTACAGGCTGCAGTCC (reverse); shark fgf3, CTTGCTCAACAGTCTTAAGTTATGG (forward) and CGGAGGAGGCTCTACTGTG (reverse); shark runx2, ATCTCTCAATCCTGCACCAGC (forward) and CCAGACAGACTCATCAATCCTCC (reverse); and shark spry2, AACTAGCACTGTGAGTAGCGG (forward) and GTTCCGAGGAGGTAAACTGGG (reverse). Riboprobes were synthesized using the Riboprobe System SP6/T7 Kit (Promega) and DIG RNA Labeling Mix (Roche). Whole-mount and section ISH was performed as previously described (4, 59). To compare sequences between the chick and shark, phylogenetic gene trees were reconstructed from protein coding sequences extracted from www.ensemble.org, aligned to S. canicula sequences obtained during probe synthesis (see fig. S1 for details) (60, 61). Whole-mount ISH samples were imaged using a Nikon SMZ15000 stereomicroscope, and sections were imaged using an Olympus BX51 microscope and Olympus DP71 Universal digital camera attachment. Vibratome sections shown in Fig. 4 were cut at a thickness of 30 μm. Adjustments to image contrast and brightness were made to improve clarity. Scale bars were added using Fiji (57).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.