Also in the Article



Bacterial DNA was extracted from mouse brains using DNeasy Blood & Tissue Kits (Qiagen, Germany) according to the manufacturer’s protocols. The concentration of DNA was measured using a NanoDrop 2000 (Thermo Fisher Scientific, USA). Bacterial DNA was amplified with 16S ribosomal RNA (rRNA) primers for the W83 strain of P. gingivalis [AGGCAGCTTGCCATACTGCG (forward) and ACTGTTAGCAACTACCGATGT (reverse)]. PCR amplification was conducted in a 12-μl reaction volume including 3 μl of brain DNA (80 ng of DNA), 6 μl of EconoTaq PLUS Green 2× Master Mix (Lucigen, USA), 0.6 μl (10 μM) of each primer (GenoMed, Poland), and 1.8 μl of H2O (Thermo Fisher Scientific, USA). Forty cycles of amplification were performed in a DNA thermal cycler (TProfessional TRIO, Biometra, Germany) consisting of 3 min for 95°C, 20 s for 95°C, 30 s for 57°C, 30 s for 72 °C, and 5 min for 72°C. The amplified product was identified by electrophoresis in a 1.5% agarose gel (BioShop, Canada). The DNA was stained with ethidium bromide, visualized under short wavelength transilluminator, and photographed in runVIEW imager (BIOCOMdirect, UK).

Note: The content above has been extracted from a research article, so it may not display correctly.



Also in the Article

Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.