Also in the Article



The preamplification and qPCR protocol used for detection of H. pylori copy number in brain, CSF, and saliva samples were the same as those used for detecting the P. gingivalis hmuY gene copy number noted above. The qPCR primers and probe used for detection of H. pylori copy number have previously been described (43). We designed two primers [GATTAGTGCCCATATTATGGA (Hpy_outer_For) and CTCACCAGGAACTAATTTAC (Hpy_outer_Rev)] for the preamplification step. These primers amplified a 217-bp fragment encompassing the region amplified by the qPCR primers. A synthetic DNA of 240 bases encompassing the region amplified by outer primers was used as a control for the preamplification step.

Note: The content above has been extracted from a research article, so it may not display correctly.



Also in the Article

Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.