Also in the Article



For sequencing, an approximately 1-kb region of the P. gingivalis genome encompassing the hmuY gene (except sequences corresponding to the first six amino acids) was amplified from 50 ng of brain DNA by PCR. PCR amplification (95°C/5 min; 95°C/20 s, 60°C/15 s, and 72°C/1 min for 35 cycles; 72°C/2 min) was performed using the KAPA HiFi HotStart ReadyMix PCR Kit (Kapa Biosystems) and primers [TTCTCCGCACTCTGTGCATT (forward) and AGCACTTCGATTCGCTCGAT(reverse)] designed to amplify the hmuY gene from the P. gingivalis genome. PCR products were run on 2% agarose gel, and DNA bands close to the expected size (based on the PCR product obtained from amplification of purified P. gingivalis DNA) were excised from the gel (Fig. 2F). DNA was extracted from the gel pieces following the protocol described in the Gel Extraction Kit (Qiagen). Approximately 5% of the eluted DNA was reamplified using the same hmuY PCR primers. Sequencing of reamplified PCR products was performed using nested primers (fig. S3).

Note: The content above has been extracted from a research article, so it may not display correctly.



Also in the Article

Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.