Sequence synthesis of prestin, site-directed mutations, and transient transfection

Bottlenose dolphin, Blainville’s beaked whale, pygmy sperm whale, and fin whale were chosen as representative living species for the functional examination of prestin; the outgroup was cow. The entire coding regions of prestin from these species and the ancestral prestin sequences inferred above were synthesized (Generay) and cloned into the expression vector pEGFP-N1 (Clontech). This yielded C-terminal green fluorescent protein (GFP) fusion constructs that were used to confirm whether prestin expresses and locates in the cell membrane. HEK 293 cells were cultured in Dulbecco’s modified Eagle’s medium with 10% fetal bovine serum, and cells were plated for 24 hours before transient transfection. Then, 4-μg prestin-GFP plasmids were transfected to HEK 293 cells using 10 μl of Lipofectamine 2000 (Invitrogen) in 500-μl Opti-MEM (Life Technologies). After 24 to 48 hours of incubation, successfully transfected cells were used for NLC measurements. We used polymerase chain reaction (PCR) technology to produce the mutants. Prestin-GFP plasmid DNA served as the templates, and the PCR primers designed to create the mutant constructs were as follows: S392A_F, CTCACTCTTCCAGACTTTTGCAATTTCATGCTCCTTGTC and S392A_R, GACAAGGAGCATGAAATTGCAAAAGTCTGGAAGAGTGAG; L497M_F, TTCTGTAAATCACAGTCATCAGTGCGATGATCACAGC and L497M_R, GCTGTGATCATCGCACTGATGACTGTGATTTACAGAA; A392S_F, CTCACTCTTCCAGACTTTTTCAATTTCATGCTCCTTGTC and A392S_R, GACAAGGAGCATGAAATTGAAAAAGTCTGGAAGAGTGAG; and M497L_F, TTCTGTAAATCACAGTCAGCAGTGCGATGATCACAGC and M497L_R, GCTGTGATCATCGCACTGCTGACTGTGATTTACAGAA. All mutational constructs were sequenced to confirm the nucleotide exchanges and sequence correction.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.