The complete open reading frame of TaBx10 was amplified from cDNA with the primers ATGGTACGTCTCAGCGCATGCCGGCCGCGCAGCACAT (forward) and ATGGTACGTCTCATATCAAGGGTATACTTCGATAATTGATCGA (reverse) and inserted as Bsm BI fragment into the vector pASK-IBA37plus (IBA-GmbH, Göttingen), which allows the expression of TaBx10 in E. coli NEB 10-beta cells (New England Biolabs) as N-terminal fusion protein. For expression, liquid cultures of bacteria harboring the expression construct were grown at 37°C and 220 rpm in lysogeny broth medium to an OD600 (optical density at 600 nm) of 0.6 to 0.8. Anhydrotetracycline was added to a final concentration of 200 μg liter−1, and the cultures were incubated for 20 hours at 18°C and 220 rpm. The cells were sedimented for 10 min at 5000g and 4°C. For breaking up the cells, the pellet was resuspended in ice-cold 4 ml of 50 mM tris-HCl (pH 8.0) containing 0.5 M NaCl, 20 mM imidazole, 20 mM 2-mercaptoethanol, and 10% glycerol and subsequently subjected to ultrasonication (4 × 20 s; Bandelin UW2070). The debris was separated by centrifugation for 20 min at 16,100g and 4°C. The N-terminal His-tagged TaBX10 was purified using Ni-NTA spin columns (Qiagen) according to the manufacturer’s instructions. The purified proteins were eluted with 50 mM tris-HCl (pH 8.0) containing 0.5 M NaCl, 250 mM imidazole, and 10% glycerol. The salt was removed by gel filtration using Illustra NAP-5 columns (GE Healthcare), and the protein was redissolved in 50 mM tris-HCl (pH 7.0) containing 10% glycerol.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.