Total RNA was extracted from leaves of 14-day-old wild-type and ZmBx12-overexpressing plants using an RNA isolation kit (Thermo Fisher Scientific, USA). Two microgram of total RNA was used for reverse transcription with SuperScript II reverse transcriptase (Invitrogen, USA). The cDNA samples were diluted to 2 to 8 ng/μl. Triplicate quantitative assays were performed on 5 μl of each cDNA dilution with the Kapa SYBR Fast qPCR Master Mix (Sigma, USA) and a LightCycler96 detection system (Roche, Switzerland) according to the manufacturer’s protocol. The relative quantification method (Delta-Delta CT) was used to evaluate quantitative variation between the replicates examined. The amplification of T. aestivum Tubulin was used as an internal control to normalize all data, and primers for Tubulin were ATCTGGTGCGGGTAACAA (forward) and AAGTGGAGGCGAGGGAAT (reverse). Gene-specific primers for ZmBx12 were ATGGCACTCATGCAAGAGAGC (forward) and TCAAGGATAGACCTCGATGATG (reverse).

For qRT-PCR analysis of TaBx10, RNA was extracted using the InviTrap Spin Plant RNA Mini Kit (Stratec, Berlin, Germany) according to the manufacturer’s instructions. cDNA was prepared from 1 μg of deoxyribonuclease-treated RNA using SuperScript III reverse transcriptase (Invitrogen, Carlsbad, CA, USA) and diluted 1:10 with water. Primers for TaBx10 were TCCCCGATGGTGGGCA (forward) and GGTGGTGTCCCAGAACGTG (reverse). Primer specificity was confirmed by agarose gel electrophoresis, melting curve analysis, and standard curve analysis and by sequence verification of cloned PCR amplicons. Primer pair efficiency (98.5%) was determined using the standard curve method with twofold serial dilutions of cDNA. Samples were run in triplicate using the Brilliant III Ultra-Fast SYBR Green QPCR Master Mix (Agilent Technologies, Santa Clara, CA, USA). The following PCR conditions were applied for all reactions: initial incubation at 95°C for 3 min, followed by 40 cycles of amplification (95°C for 10 s, 60°C for 10 s). All samples were run on the same PCR machine (CFX Connect Real-Time System; Bio-Rad Laboratories, Hercules, CA, USA) in an optical 96-well plate. Six biological replicates for each treatment were analyzed as triplicates.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.