MET-2. To generate EL634, we inserted the 3xFLAG tag (DYKDHDGDYKDHDIDYKDDDDK) at the endogenous met-2 locus using CRISPR (34). The construct places the tag at the N terminus of MET-2 and is inserted immediately after the start codon without any linker sequences. To generate EL597, we inserted a single copy of MET-2::GFP with its endogenous promoter and upstream gene R05D3.2 at the ttTi5605 locus on chromosome II by MosSCI. The GFP tag was placed at the C terminus of MET-2 and was inserted immediately before the stop codon without any linker sequences. Both the CRISPR construct and the MosSCI construct could rescue H3K9me2 deposition, although the CRISPR allele did so better than the MosSCI allele. The MET-2 antibody was generated against the first 17 amino acids of endogenous MET-2 and affinity-purified.

To generate SM2580 (NLS::3xFLAG::MET-2), the c-Myc NLS sequence (CCAGCCGCCAAGCGTGTCAAGCTCGAC) was added directly upstream of 3xFLAG::MET-2 without any linker sequence by CRISPR (34). For the insertion, the 3xFlag sequence in EL634 was targeted by the following guide RNA: ATGGACTACAAAGACCATGA(CGG). The dpy-10 locus was used as a phenotypic marker. Because it segregated independently from the met-2 locus, nonroller non-dpy worms were isolated for further analysis by single worm PCR and genotyping. The edit was confirmed by sequencing the 200–base pair (bp) region around the insertion. CRISPR RNA (crRNA), transactivating crRNA (tracrRNA), and CRISPR-associated protein 9 (Cas9) protein were ordered from the Integrated DNA Technologies (IDT) Alt-R genome editing system. The 97-bp repair template was synthesized and polyacrylamide gel electrophoresis (PAGE)–purified by IDT.

LIN-65. We inserted a 3xFLAG at the endogenous lin-65 locus using CRISPR (34). The sequence of the guide RNA was TCATTCGAGAGTGATGAAGG(TGG). The 3xFLAG tag was located at the C terminus of LIN-65 and was inserted directly before the stop codon without any linker sequences. The dpy-10 locus was used as a phenotypic marker. Because it segregated independently from the lin-65 locus, nonroller non-dpy worms were isolated for further analysis by single worm PCR and genotyping. The edit was confirmed by sequencing the 200-bp region around the insertion. crRNA, tracrRNA, and Cas9 protein were ordered from the IDT Alt-R genome editing system. The 136-bp repair template was synthesized and PAGE-purified by IDT.

ARLE-14. An antibody against endogenous ARLE-14 was generated. Bacteria containing arle-14 complementary DNA (cDNA) in a pET-47b(+) (#71461, Novagen) plasmid backbone were grown at 30°C for 19 hours in LB + kanamycin (50 μg/ml). The culture was diluted 1:5 in LB + kanamycin, and protein expression was induced with 0.25 mM isopropyl-β-d-thiogalactopyranoside at 30°C for 3 hours. Bacteria were pelleted and flash-frozen at −80°C. The pellet was resuspended in 20 ml of lysis buffer [50 mM tris (pH 7.2), 300 mM NaCl, 5 mM β-ME, and 10% glycerol] and digested with 200 μl of lysozyme (50 mg/ml; #90082, Thermo Fisher Scientific) for 30 min on ice. Following lysozyme digestion and sonication on ice (four cycles, 30 s ON, 1 min OFF; output control 3, duty cycle 50%, pulsed), the protein was purified from inclusion bodies as follows: The sample was centrifuged at 4000 rpm at 4°C for 15 min and the supernatant was discarded. The pellet was resuspended in 20 ml of lysis buffer with 1% Triton X-100 and 200 μl of TURBO DNase (deoxyribonuclease; Thermo Fisher Scientific AM2239) and incubated for 20 min at room temperature. The sample was sonicated and centrifuged again with the same settings as before, and the supernatant was discarded. The pellet was rinsed once with dilution buffer [10 mM tris-Cl (pH 7.5),150 mM NaCl, and 0.5 mM EDTA] and resuspended in denaturation buffer [50 mM tris-HCl (pH 8), 300 mM NaCl, 2 mM β-ME, 5 mM MgCl2, and 6 M urea] by gentle rocking on a shaker at room temperature for 1 hour. The solution was dialyzed against 50 mM tris-Cl (pH 8), 150 mM NaCl, 5 mM MgCl2, and protein (1 mg/ml) and was sent to Covance for injections into rabbits. Total immunoglobulin G purification was performed by Covance after the final bleed. For in vivo imaging, the antibody solution was precleared overnight with arle-14(tm6845) mutant embryos before use. Protocol described in the “Antibody staining” section was followed to prepare arle-14(tm6845) embryos and to stain them with the ARLE-14 antibody. The resulting precleared antibody solution was transferred to a fresh tube, stored at 4°C for <1 week, and used in staining experiments.

ZEN-4. ZEN-4::GFP was amplified from bsem1129 (35) with zen-4_uni_5′_nested_2_attB1 (GGGGACAAGTTTGTACAAAAAAGCAGGCTGCAAAAAGTCGCATCTGGGAA; attB1 underlined) and unc-54_3′UTR_Hobert_nested_3′_attB2 (GGAAACAGTTATGTTTGGTATATTGGGACCCAGCTTTCTTGTACAAAGTGGTCCCC; attB2 underlined) primers using TaKaRa PrimeSTAR (35). The resulting attB-flanked PCR product was recombined into pCFJ151 (Addgene) using Gateway BP Clonase II (Invitrogen/Thermo Fisher Scientific) to create bsem1267. SM2333 was generated by injecting bsem1267 along with pCFJ601, pMA122, pGH8, pCFJ90, and pCFJ104 (all available from Addgene) into SM2288 [ttTiS605 II; unc-119(ed3)III]. The mosSCI protocol on www.wormbuilder.org was used to generate single integrants. SM2333 was used as an on-slide WT control in antibody stains.

HIS-72. The mCherry tag was inserted at the C terminus of the endogenous his-72 locus by CRISPR. Briefly, JAC499 was injected with Cre recombinase to remove the selection cassette and produce a functional HIS-72::mCherry protein. JAC500 his-72(csb43[his-72::mCherry]) III was used as a histone control in MET-2::GFP stains (Fig. 2C) and to mark cross-progeny after mating (Fig. 4H and fig. S4E). The mCherry tag did not interfere with H3K9me2 (fig. S2C).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.