Wild-type, GLP1R-expressing, or GPR40-expressing HEK293 cells were seeded at a density of 30,000 cells per well in 96-well plates and treated with ASO or ASO conjugates as indicated for approximately 24 hours before harvest. Total RNA was extracted from cells or tissue samples using the RNeasy Micro Kit or Mini Kit (Qiagen). Complementary DNA (cDNA) was generated using a High-Capacity cDNA Reverse Transcription kit (Applied Biosystems). Reverse transcription qPCR analysis was performed with a QuantStudio 7 Flex using MALAT1 TaqMan assays (human Hs01054576 and mouse Mm01227912, Applied Biosystems) following the manufacturer’s instructions. Mouse FOXO1 was measured using the following primer probe set: forward sequence, CAAAGTCACATACGGCCAATCC; reverse sequence, CGTAACTTGATTTGCTGTCCTGAA; and probe, TGAGCCCTTTGCCCCAGATGCCTAT. The data were normalized against acidic ribosomal phosphoprotein P0 (36B4) expression measured using the following primer probe sets: HEK293 cells, CCATTCTATCATCAACGGGTACAA (forward sequence) and AGCAAGTGGGAAGGTGTAATCC (reverse sequence); mouse islets, GAGGAATCAGATGAGGATATGGGA (forward sequence), AAGCAGGCTGACTTGGTTGC (reverse sequence), and TCGGTCTCTTCGACTAATCCCGCCAA (probe sequence).

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.