Generation of Bok KO HeLa Cell Lines
This protocol is extracted from research article:
Identification of the Bok Interactome Using Proximity Labeling
Front Cell Dev Biol, May 31, 2021; DOI: 10.3389/fcell.2021.689951

The CRISPR-Cas9 system using the pCas-Guide-EF1a-GFP vector (#GE100018, OriGene) was used to generate Bok KO HeLa cells by targeting exon 2 (GTCTGTGGGCGAGCGGTCAA) or exon 4 (GCCCCGCGGCCACCGCATAC). Cells were transfected using Lipofectamine 2000, medium was changed after 24 h, and 48 h post-transfection, EGFP-expressing cells were selected by fluorescence-activated cell sorting and were seeded at one cell/well in a 96-well plate. Colonies were expanded and assessed for Bok immunoreactivity as described (Schulman et al., 2016). Multiple independent Bok KO cell lines for each exon target were used for all experiments.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.