The complete coding sequence of ETS1 was amplified by PCR from human genomic DNA using the forward primer, 5′- GGAATTCC GCCACCATGAGCTACTTTGTGGATTCT-3′ and reverse primer, 5′- ACGCGTCGACTCACTCGTCGGCATCTGG CTT-3′. The ETS1 plasmid was constructed by inserting the CDS into a mammalian expression vector, pCDH-EF1-copGFP (Addgene, Inc.), which contained a CMV promoter driving the expression of GFP and ETS1. The negative control used in this study was the empty vector. A total of 2.5 µg pCDH-EF1-copGFP-ETS1 (pCDH ETS1) or empty vector (pCDH Blank) was transfected into BEAS-2B cells (105 cells per well of 6-well plate) to rescue the low-expression induced by mimic transfection. Transfection was performed using Lipofectamine® 6000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. After 48 h, transfected cells were harvested for further detection.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.