Aliquots containing 2×105 BEAS-2B cells were seeded in each well of 6-well plates and cultured for 24 h. Then, the cells were transfected with: i) 50 nM mimic of miR-200b (UAAUACUGCCUGGUAAUGAUGA); ii) mimic negative control (NC, UUCUCCGAACGUGUCA); iii) 100 nM inhibitor of miR-200b (UCAUCAUUACCAGGCGGUAUUA); or iv) 5-carboxyfluorescein (FAM) labeled inhibitor NC (CAGUACUUUUGUGUAGUACAA). The four oligos were obtained from Guangzhou RiboBio Co., Ltd. Transfection was performed using Lipofectamine® 6000 reagent (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol. Transfection efficiency was evaluated by reverse transcription-quantitative (RT-q)PCR and fluorescence of FAM-inhibitor NC transfected cells. The cells were harvested 24 h after transfection and used for wound healing and Transwell assays, as well as for RNA and protein extraction, as described below.

Note: The content above has been extracted from a research article, so it may not display correctly.



Q&A
Please log in to submit your questions online.
Your question will be posted on the Bio-101 website. We will send your questions to the authors of this protocol and Bio-protocol community members who are experienced with this method. you will be informed using the email address associated with your Bio-protocol account.



We use cookies on this site to enhance your user experience. By using our website, you are agreeing to allow the storage of cookies on your computer.