Rapid Amplification of cDNA Ends (RACE)

RACE of IVRPIE was performed using a SMARTer^TM RACE cDNA Amplification Kit (Clontech) according to the manufacturer’s instructions. The primers for IVRPIE 5′ RACE were as follows: IVRPIE outer R, 5′-TCTGTGGTGCACATGC TGTCTTCCGT-3′ and IVRPIE inner R, 5′-GATTACGCC AAGCTTAAGCATTTCCCGAGTTTGCTGGAACACA-3′. The primers for IVRPIE 3′ RACE were as follows: IVRPIE outer F, 5′-GATGAGAAGTCTGAGGCTTTACCTAAACTTCA-3′ and IVRPIE inner F, 5′- AAACTTATGATTAAAGGCTTCTA CGTACTCA-3′.