Generation of new tj mutations

TP Trupti Panchal
XC Xi Chen
EA Ekaterina Alchits
YO Youjin Oh
JP James Poon
JK Jane Kouptsova
FL Frank A. Laski
DG Dorothea Godt
request Request a Protocol
ask Ask a question
Favorite

tjDf1, a transcriptional null mutation is a genomic deletion of 13.3 kb (2L:19464294–19477599), beginning 286 bp upstream of the tj start codon and ending 9.8 kb downstream of the tj transcription unit (S1A Fig). This mutation deletes the complete coding and 3' UTR sequences of tj, and three predicted RNA coding genes. tjDf1 was generated by FLP-mediated recombination between the FRT elements of the transposable elements P{XP}d06467 and PBac{WH}f02713 [77,78] (Exelixis Collection at the Harvard Medical School), using the technique described by Parks et al. [79]. We screened for recombinant flies by eye color as recombinant chromosomes containing a deletion were expected to carry two mini-white genes. Recombination was confirmed by PCR analysis, using genomic DNA from homozygous tjDf1 flies. Primer pair AGCGAATGGTGGCGTTCGAGCTC—ACCACCTTATGTTATTTCATCAT confirmed the presence of the 3' end of P{XP}d06467, primer pair CCTCGATATACAGACCGATAA—AGCCAAATGAACTGCCCGCT the presence of the 3' end of PBac{WH}f02713, and primer pair GACCTTTGAAACCACCCACTAAC—GTGGTGTGCGTAAGTCTGAGC the absence of tj-specific sequences. tjDf1 is homozygous viable, but both female and male sterile.

tj39, a weak hypomorphic allele was generated in a P element excision mutagenesis, using tj-Gal4 (P{GawB}NP1624), which is located in the 5' UTR of tj, 0.7 kb upstream of the translation start site [72], as a starter line. tj39 caused strongly reduced fertility in trans to tjeo2 (approximately 20% of the fertility of the tjeo2/+ control), whereas 29 other excision mutations were fully fertile in trans to tjeo2. PCR analysis, using genomic DNA of homozygous mutant tj39 flies and four primer (P) pairs (P2: GCTCTTGCACAGTGGTCGAG—P1: ACCACCTTATGTTATTTCATCAT, P1: ACCACCTTATGTTATTTCATCAT—P3: GTGTCGTTTATGGTGGGATC, and P2: GCTCTTGCACAGTGGTCGAG—P4: GAACTCCTGTTGGAAACGTG showed that the genomic sequences flanking the insertion site are still present and revealed a partially excised P element (the 3' end is still present). Sequencing the PCR-amplified tj coding region, using primers described in Li et al. [36], confirmed that the tj open reading frame is intact, suggesting that the remaining P element impairs tj expression at the transcriptional or translational level. Subsequent tests revealed that tj-Gal4 itself is a weak hypomorphic allele of tj, causing a similar phenotype in trans to a tj null allele as its derivative tj39. tj39 tested positively for Gal4 activity.

Do you have any questions about this protocol?

Post your question to gather feedback from the community. We will also invite the authors of this article to respond.

0/150

tip Tips for asking effective questions

+ Description

Write a detailed description. Include all information that will help others answer your question including experimental processes, conditions, and relevant images.

post Post a Question
0 Q&A